ID: 1094781303_1094781312

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1094781303 1094781312
Species Human (GRCh38) Human (GRCh38)
Location 12:33795195-33795217 12:33795227-33795249
Sequence CCCACCCCCAAATGTGCCAGCAG AATATAAAAAGAGCTAAGTTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 5, 3: 43, 4: 654}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!