ID: 1094814676_1094814680

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1094814676 1094814680
Species Human (GRCh38) Human (GRCh38)
Location 12:34171254-34171276 12:34171297-34171319
Sequence CCTGGAGGACAACTTAGAAGATA CTTGTCCATCATGAGAAGACAGG
Strand - +
Off-target summary No data {0: 7, 1: 4, 2: 3, 3: 16, 4: 178}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!