ID: 1094838864_1094838883

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1094838864 1094838883
Species Human (GRCh38) Human (GRCh38)
Location 12:34334717-34334739 12:34334747-34334769
Sequence CCCTGGCCCCCCCCCACCAGGCC CCGCGCATGCGCGGGGTCCCTGG
Strand - +
Off-target summary No data {0: 2, 1: 7, 2: 13, 3: 32, 4: 154}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!