ID: 1094841970_1094841981

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1094841970 1094841981
Species Human (GRCh38) Human (GRCh38)
Location 12:34346000-34346022 12:34346015-34346037
Sequence CCCGGGACCCCGCGCATGCGCGG ATGCGCGGTAGGGGCGGCGAGGG
Strand - +
Off-target summary {0: 2, 1: 7, 2: 13, 3: 32, 4: 154} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!