ID: 1094843991_1094844003

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1094843991 1094844003
Species Human (GRCh38) Human (GRCh38)
Location 12:34353518-34353540 12:34353554-34353576
Sequence CCCACAGTCCGCTGGGCCCCACG GAGGCACTTTCACCTGTGGAAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!