ID: 1095097198_1095097206

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1095097198 1095097206
Species Human (GRCh38) Human (GRCh38)
Location 12:38155067-38155089 12:38155085-38155107
Sequence CCATGAGGGACACCCCAAAGCAG AGCAGCAAGAAGGCCTCCGGGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 5, 3: 25, 4: 263} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!