ID: 1095098626_1095098631

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1095098626 1095098631
Species Human (GRCh38) Human (GRCh38)
Location 12:38160723-38160745 12:38160741-38160763
Sequence CCCCCTGAGGGCGAGACACGCAC CGCACCCTGTGTGCAAGACAGGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 30, 3: 57, 4: 155}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!