ID: 1095112858_1095112867

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1095112858 1095112867
Species Human (GRCh38) Human (GRCh38)
Location 12:38317061-38317083 12:38317086-38317108
Sequence CCAGGTGGGGTGCCCAACCTGTC CACCCCAGGAGAGGCCTGAAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 10, 4: 87} {0: 1, 1: 1, 2: 7, 3: 17, 4: 240}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!