ID: 1095118915_1095118917

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1095118915 1095118917
Species Human (GRCh38) Human (GRCh38)
Location 12:38390272-38390294 12:38390325-38390347
Sequence CCATCATATATTTTAAAAGCTCA AATGGACAAGAGTTATGAACAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 60, 4: 355}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!