ID: 1095145768_1095145770

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1095145768 1095145770
Species Human (GRCh38) Human (GRCh38)
Location 12:38724064-38724086 12:38724097-38724119
Sequence CCAGCATGAAAATTATCTACAAG TACTTCCCATTTTAGATAAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 175} {0: 1, 1: 0, 2: 2, 3: 42, 4: 407}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!