ID: 1095154965_1095154971

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1095154965 1095154971
Species Human (GRCh38) Human (GRCh38)
Location 12:38841830-38841852 12:38841857-38841879
Sequence CCAGAAGTCCTGTGACTTCCTTT AGGGAGAAGCAGAAAGATGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 274} {0: 1, 1: 1, 2: 10, 3: 141, 4: 1278}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!