ID: 1095190926_1095190935

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1095190926 1095190935
Species Human (GRCh38) Human (GRCh38)
Location 12:39257267-39257289 12:39257310-39257332
Sequence CCTGCCCAGCAGAGACCATGGTA CCCTGAAGGCAGAGCTCAGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 44, 4: 425}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!