ID: 1095193691_1095193697 |
View in Genome Browser |
Spacer: 13 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1095193691 | 1095193697 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 12:39287770-39287792 | 12:39287806-39287828 |
Sequence | CCCTTTACAGAAAAAAACTTTGC | TTGATTCCTCCAGGACAGGGAGG |
Strand | - | + |
Off-target summary | No data | No data |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |