ID: 1095204161_1095204162

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1095204161 1095204162
Species Human (GRCh38) Human (GRCh38)
Location 12:39420325-39420347 12:39420350-39420372
Sequence CCAAGAGGTCAGACAGAGAGTAG CTCTCATCACAGATGTAGCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 215} {0: 1, 1: 0, 2: 2, 3: 10, 4: 138}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!