ID: 1095230715_1095230717

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1095230715 1095230717
Species Human (GRCh38) Human (GRCh38)
Location 12:39735927-39735949 12:39735952-39735974
Sequence CCACAAAGCTTTAAGAGAAGTAT TTGGAGAAACACTGCCAGCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 265} {0: 1, 1: 0, 2: 8, 3: 55, 4: 252}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!