ID: 1095234333_1095234338

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1095234333 1095234338
Species Human (GRCh38) Human (GRCh38)
Location 12:39778365-39778387 12:39778383-39778405
Sequence CCAGCTCTTGGGGGCCAGCTGTA CTGTAGGGATGACTCTTCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 129} {0: 2, 1: 0, 2: 2, 3: 6, 4: 128}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!