ID: 1095234333_1095234339

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1095234333 1095234339
Species Human (GRCh38) Human (GRCh38)
Location 12:39778365-39778387 12:39778384-39778406
Sequence CCAGCTCTTGGGGGCCAGCTGTA TGTAGGGATGACTCTTCCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 129} {0: 2, 1: 0, 2: 0, 3: 7, 4: 137}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!