ID: 1095261715_1095261724

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1095261715 1095261724
Species Human (GRCh38) Human (GRCh38)
Location 12:40105829-40105851 12:40105868-40105890
Sequence CCCGGGGGGACGCGGCTCCGCGG AGCTAGACAGCCCGAGCCGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 143} {0: 1, 1: 0, 2: 1, 3: 7, 4: 66}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!