ID: 1095271446_1095271461

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1095271446 1095271461
Species Human (GRCh38) Human (GRCh38)
Location 12:40224570-40224592 12:40224618-40224640
Sequence CCCCGGCTGGCGGGTCGCGGAGG CGCCTCCGCTGCGGGGCTCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 182} {0: 1, 1: 0, 2: 2, 3: 27, 4: 236}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!