ID: 1095275562_1095275567

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1095275562 1095275567
Species Human (GRCh38) Human (GRCh38)
Location 12:40278644-40278666 12:40278662-40278684
Sequence CCCTGAGGGCTACCACACATGGC ATGGCTATGCAGGCTGTGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 113} {0: 1, 1: 0, 2: 5, 3: 22, 4: 280}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!