ID: 1095345992_1095345995

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1095345992 1095345995
Species Human (GRCh38) Human (GRCh38)
Location 12:41149041-41149063 12:41149068-41149090
Sequence CCCATATCACTATCAGCATTTTG AAACCTCTCAACAAGTCACTAGG
Strand - +
Off-target summary {0: 38, 1: 78, 2: 68, 3: 54, 4: 259} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!