ID: 1095460111_1095460124

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1095460111 1095460124
Species Human (GRCh38) Human (GRCh38)
Location 12:42434466-42434488 12:42434515-42434537
Sequence CCCTCAGTTTATAGTTGCCTGGT TGAATTGGTTTCTGTATTGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 146} {0: 1, 1: 0, 2: 0, 3: 20, 4: 216}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!