ID: 1095475791_1095475794

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1095475791 1095475794
Species Human (GRCh38) Human (GRCh38)
Location 12:42586173-42586195 12:42586196-42586218
Sequence CCTAACTCCTTCTCTTTATTGTG GAATAATCATACATAGATTTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 29, 4: 333} {0: 1, 1: 0, 2: 2, 3: 24, 4: 320}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!