ID: 1095520026_1095520032

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1095520026 1095520032
Species Human (GRCh38) Human (GRCh38)
Location 12:43052568-43052590 12:43052606-43052628
Sequence CCTCTTTTTTCAAAGCCAGCAGG GGGTGTTCCCAGAAGACTCAAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!