|
Left Crispr |
Right Crispr |
| Crispr ID |
1095552470 |
1095552477 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
12:43459166-43459188
|
12:43459212-43459234
|
| Sequence |
CCGCCTACCACTGCTGTTTGCTG |
TCCATCCCTCCGGATCCAACAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 3, 2: 40, 3: 115, 4: 361} |
{0: 1, 1: 17, 2: 73, 3: 125, 4: 220} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|