ID: 1095559993_1095559995

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1095559993 1095559995
Species Human (GRCh38) Human (GRCh38)
Location 12:43552647-43552669 12:43552660-43552682
Sequence CCGGGCCTCACTTGCATGGGCCC GCATGGGCCCCTGTGTGTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 35, 4: 256} {0: 1, 1: 0, 2: 5, 3: 42, 4: 248}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!