ID: 1095578449_1095578458

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1095578449 1095578458
Species Human (GRCh38) Human (GRCh38)
Location 12:43766360-43766382 12:43766409-43766431
Sequence CCTCCTACTCCAACCAAATCTGT CTGCTTGATGCCCCTTTTCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 211} {0: 1, 1: 0, 2: 1, 3: 10, 4: 225}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!