|
Left Crispr |
Right Crispr |
| Crispr ID |
1095587382 |
1095587392 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
12:43863930-43863952
|
12:43863956-43863978
|
| Sequence |
CCGGCGCTTGCGGGCCAGCTAGA |
CCGGGTGGGCATGGGCTTGGCGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 13, 2: 14, 3: 14, 4: 57} |
{0: 57, 1: 514, 2: 500, 3: 384, 4: 588} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|