ID: 1095612288_1095612291

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1095612288 1095612291
Species Human (GRCh38) Human (GRCh38)
Location 12:44144557-44144579 12:44144572-44144594
Sequence CCTGCCATTTCTATTGATTGCTT GATTGCTTCTTACCTGGAACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 269} {0: 1, 1: 0, 2: 0, 3: 7, 4: 123}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!