ID: 1095626592_1095626594

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1095626592 1095626594
Species Human (GRCh38) Human (GRCh38)
Location 12:44321611-44321633 12:44321661-44321683
Sequence CCTTGAGAATGGAGAGATGGAAA AGTAAAAACTTATATTATGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 44, 4: 382} {0: 1, 1: 0, 2: 1, 3: 31, 4: 380}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!