ID: 1095650528_1095650532

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1095650528 1095650532
Species Human (GRCh38) Human (GRCh38)
Location 12:44603718-44603740 12:44603767-44603789
Sequence CCTTTTGTGAAGTGGTAAATGAA TGATGCAGAAACAGAAATGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 282} {0: 1, 1: 0, 2: 6, 3: 62, 4: 585}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!