ID: 1095673711_1095673715

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1095673711 1095673715
Species Human (GRCh38) Human (GRCh38)
Location 12:44891427-44891449 12:44891456-44891478
Sequence CCATAAAGGGTCCTCTGCTCTCG AAACTACCACTGCTGGAGCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 57} {0: 1, 1: 0, 2: 0, 3: 14, 4: 143}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!