|
Left Crispr |
Right Crispr |
| Crispr ID |
1095674211 |
1095674217 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
12:44897745-44897767
|
12:44897769-44897791
|
| Sequence |
CCTGGAATGCCCCCGAGACAGAA |
TGTTTACTCCCCTGGAAAAGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 1, 2: 95, 3: 383, 4: 521} |
{0: 2, 1: 16, 2: 178, 3: 397, 4: 1004} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|