ID: 1095709464_1095709466

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1095709464 1095709466
Species Human (GRCh38) Human (GRCh38)
Location 12:45273077-45273099 12:45273116-45273138
Sequence CCTCACTTACATGTGAAATCTAA GAGAATAGAACAGTGATTGCCGG
Strand - +
Off-target summary {0: 2, 1: 19, 2: 63, 3: 127, 4: 500} {0: 1, 1: 2, 2: 6, 3: 67, 4: 396}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!