ID: 1095749785_1095749798

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1095749785 1095749798
Species Human (GRCh38) Human (GRCh38)
Location 12:45697353-45697375 12:45697401-45697423
Sequence CCCTGAGAGTGCAGGGATGCCCA GCAGCTGCACTTGGGAGCCCAGG
Strand - +
Off-target summary {0: 7, 1: 19, 2: 66, 3: 113, 4: 387} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!