ID: 1095794633_1095794637

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1095794633 1095794637
Species Human (GRCh38) Human (GRCh38)
Location 12:46204881-46204903 12:46204910-46204932
Sequence CCAGAATCCAGCAGAAAAGAGCC TTTTTGCTGTAAGTCTGTGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 191} {0: 1, 1: 0, 2: 1, 3: 23, 4: 303}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!