ID: 1095794633_1095794638

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1095794633 1095794638
Species Human (GRCh38) Human (GRCh38)
Location 12:46204881-46204903 12:46204913-46204935
Sequence CCAGAATCCAGCAGAAAAGAGCC TTGCTGTAAGTCTGTGTTGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 191} {0: 1, 1: 0, 2: 0, 3: 13, 4: 222}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!