ID: 1095801218_1095801222

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1095801218 1095801222
Species Human (GRCh38) Human (GRCh38)
Location 12:46271212-46271234 12:46271244-46271266
Sequence CCTTCTCTGGATTTTAGTTGACA CAGAGTAAACATCAACATGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 256} {0: 1, 1: 0, 2: 0, 3: 7, 4: 151}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!