ID: 1095810342_1095810344

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1095810342 1095810344
Species Human (GRCh38) Human (GRCh38)
Location 12:46367921-46367943 12:46367936-46367958
Sequence CCAGGAGTTCGAGATCAGCTTGG CAGCTTGGACAACATAACATAGG
Strand - +
Off-target summary {0: 30, 1: 1399, 2: 17880, 3: 64092, 4: 68197} {0: 1, 1: 0, 2: 0, 3: 13, 4: 144}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!