ID: 1095811255_1095811263

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1095811255 1095811263
Species Human (GRCh38) Human (GRCh38)
Location 12:46374546-46374568 12:46374569-46374591
Sequence CCCAGTTAGAGGTGCTAAGGAGG CCCTCAGGGTTGGTAGTTATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 102} {0: 1, 1: 0, 2: 0, 3: 3, 4: 80}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!