ID: 1095815431_1095815439

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1095815431 1095815439
Species Human (GRCh38) Human (GRCh38)
Location 12:46417052-46417074 12:46417100-46417122
Sequence CCTTGCAACTTCTGCTTCCCAGG TCCCGAGTAGTTGGGACTACAGG
Strand - +
Off-target summary {0: 2, 1: 42, 2: 298, 3: 900, 4: 1898} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!