|
Left Crispr |
Right Crispr |
Crispr ID |
1095847357 |
1095847363 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
12:46759992-46760014
|
12:46760023-46760045
|
Sequence |
CCTTTTGTAAATTGCCCAGTCCC |
CTTTATTAGTAGTGTGAAAAAGG |
Strand |
- |
+ |
Off-target summary |
{0: 2, 1: 35, 2: 72, 3: 186, 4: 344} |
{0: 2, 1: 154, 2: 1433, 3: 1997, 4: 3672} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|