ID: 1095847360_1095847363

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1095847360 1095847363
Species Human (GRCh38) Human (GRCh38)
Location 12:46760007-46760029 12:46760023-46760045
Sequence CCAGTCCCTGGTATGTCTTTATT CTTTATTAGTAGTGTGAAAAAGG
Strand - +
Off-target summary {0: 2, 1: 127, 2: 1919, 3: 5902, 4: 9224} {0: 2, 1: 154, 2: 1433, 3: 1997, 4: 3672}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!