|
Left Crispr |
Right Crispr |
| Crispr ID |
1095847360 |
1095847363 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
12:46760007-46760029
|
12:46760023-46760045
|
| Sequence |
CCAGTCCCTGGTATGTCTTTATT |
CTTTATTAGTAGTGTGAAAAAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 127, 2: 1919, 3: 5902, 4: 9224} |
{0: 2, 1: 154, 2: 1433, 3: 1997, 4: 3672} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|