ID: 1095881391_1095881401

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1095881391 1095881401
Species Human (GRCh38) Human (GRCh38)
Location 12:47141211-47141233 12:47141257-47141279
Sequence CCCTTGATCATATTTCCCCACAG ATGGACAAAAGTGCCTTTGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 185} {0: 3, 1: 12, 2: 17, 3: 36, 4: 219}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!