|
Left Crispr |
Right Crispr |
| Crispr ID |
1095883320 |
1095883328 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
12:47162556-47162578
|
12:47162595-47162617
|
| Sequence |
CCAATATCTGCTTCTGGTGAGGG |
ATCATGATGGAAGGCAAAGAGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 6, 1: 57, 2: 371, 3: 760, 4: 989} |
{0: 7, 1: 96, 2: 591, 3: 1228, 4: 2767} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|