ID: 1095884786_1095884793

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1095884786 1095884793
Species Human (GRCh38) Human (GRCh38)
Location 12:47177574-47177596 12:47177595-47177617
Sequence CCTATGTTGTACTGATGCCTTAG AGTCCAGCCTGGTGGTGGGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 79} {0: 1, 1: 1, 2: 4, 3: 59, 4: 499}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!