|
Left Crispr |
Right Crispr |
| Crispr ID |
1095890678 |
1095890684 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
12:47233148-47233170
|
12:47233163-47233185
|
| Sequence |
CCTTCCACCTTGGCCTTCCAAAG |
TTCCAAAGTGCTGGGTTTGCAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 52, 1: 2206, 2: 28156, 3: 83347, 4: 161118} |
{0: 1, 1: 339, 2: 17136, 3: 314030, 4: 261311} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|