ID: 1095893106_1095893114

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1095893106 1095893114
Species Human (GRCh38) Human (GRCh38)
Location 12:47253016-47253038 12:47253062-47253084
Sequence CCTGCCTGATCTGGAGGGATGGA TGGCAGACAGCAGTGGTGGATGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!