ID: 1095951338_1095951352

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1095951338 1095951352
Species Human (GRCh38) Human (GRCh38)
Location 12:47783546-47783568 12:47783594-47783616
Sequence CCTGAGGAATGGGGGCCACAGCC TGTTCTCGAGAGCCCTGTGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 280} {0: 1, 1: 0, 2: 0, 3: 9, 4: 97}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!