ID: 1095958297_1095958309

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1095958297 1095958309
Species Human (GRCh38) Human (GRCh38)
Location 12:47819044-47819066 12:47819077-47819099
Sequence CCTGTCCCCCACCCCTCACACAG CCCGCTTCCCGCGCCGCTGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 11, 3: 112, 4: 970} {0: 1, 1: 1, 2: 1, 3: 22, 4: 176}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!